Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10604

HP ID(1) HP10604
Gene ID(2) 54458
Gene Symbol finder PRR13
Protein Name proline rich 13
RefSeq NM_018457.3
Length of RefSeq (bp) 1262
Chromosome 12q12
Reference DDBJ accession
UniGene Hs.426359

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe45H03 pKA1U5 GGCGAAGGAGAACGCAGCAAGCCCAGGCGGCGGTGGAAAGGCTGGAGGACACACCTAAAC
ARe55F06 pKA1U5 GGAACGCAGCAAGCCCAGGCGGCGGTGGAAAGGCTGNAGGACACACCTAAACATGTGGAA
ARe92B02 pKA1U5 GGCGAAGGAGAACGCAGCAAGCCCAGGCGGCGGTGGAAAGGTGATGGGGCTGGAGGACAC
ARiS049N23 pGCAP10 GTGCGAAGGAGAACGCAGCAAGCCCAGGCGGCGGTGGAAAGGCTGGAGGACACACCTAAA
ARiS087B19 pGCAP10 GNNCNCANCANGCCCANGCNGCGGNGGAAAGGCTGGAGGACACACCTAAACATGTGGAAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl