Prev. | 

RIKEN DNA Bank Human Resource - PRR13

Gene ID NCBI Gene 54458 |  KEGG hsa:54458
Gene Symbol PRR13
Protein Name proline rich 13
Synonyms TXR1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY066879 IRAK167D07 pBluescriptR BC066943 NM_018457 Full/var
HGY085964 IRAL014P04 pOTB7 BC004512 NM_001005354 Partial
HGY092368 IRAL030P08 pOTB7 BC014257 NM_018457 Full
HGY093654 IRAL034C06 pOTB7 BC016064 NM_018457 Full
HGY103579 IRAL058P19 pOTB7 BC071979 NM_001005354 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR058171 ARe45H03 pKA1U5 NM_018457.3  
GGCGAAGGAGAACGCAGCAAGCCCAGGCGGCGGTGGAAAGGCTGGAGGACACACCTAAAC
HKR062126 ARe55F06 pKA1U5 NM_018457.3  
GGAACGCAGCAAGCCCAGGCGGCGGTGGAAAGGCTGNAGGACACACCTAAACATGTGGAA
HKR076826 ARe92B02 pKA1U5 NM_018457.3  
GGCGAAGGAGAACGCAGCAAGCCCAGGCGGCGGTGGAAAGGTGATGGGGCTGGAGGACAC
HKR219935 ARiS049N23 pGCAP10 NM_018457.3  
GTGCGAAGGAGAACGCAGCAAGCCCAGGCGGCGGTGGAAAGGCTGGAGGACACACCTAAA
HKR234843 ARiS087B19 pGCAP10 NM_018457.3  
GNNCNCANCANGCCCANGCNGCGGNGGAAAGGCTGGAGGACACACCTAAACATGTGGAAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl