Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10593

HP ID(1) HP10593
Gene ID(2) 286053
Gene Symbol finder NSMCE2
Protein Name non-SMC element 2, MMS21 homolog (S. cerevisiae)
RefSeq NM_173685.1
Length of RefSeq (bp) 1258
Chromosome 8q24.13
Reference DDBJ accession
UniGene Hs.388297

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS007K17 pGCAP10 GAGAGCCCGCTCTCACTTTTCAGCGGCAGGCGAAGGGGGATGAGGAAAGGAGGTGGGTCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl