Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NSMCE2

Gene ID (NCBI) 286053
Gene Symbol NSMCE2
Protein Name non-SMC element 2, MMS21 homolog (S. cerevisiae)
Synonyms C8orf36|MMS21|NSE2|ZMIZ7
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX027366 IRAK068G22 pCMV-SPORT6 BC032797 NM_173685

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR403057 RBdS007K17 pGCAP10 NM_173685.1
GAGAGCCCGCTCTCACTTTTCAGCGGCAGGCGAAGGGGGATGAGGAAAGGAGGTGGGTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.06

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl