Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10587

HP ID(1) HP10587
Gene ID(2) 51248
Gene Symbol finder PDZD11
Protein Name PDZ domain containing 11
RefSeq NM_016484.4
Length of RefSeq (bp) 1246
Chromosome Xq13.1
Reference DDBJ accession
UniGene Hs.11042

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe60A07 pKA1U5 GATCCGCTTCCGGTTCCCAGACTGAATTGTCAGTGAGCGGAGTCTGAGGTCGCTGTGGAC
RBb42B05 pGCAP1 GCATCCGCTTCCGGTTCCCAGACTGAATTGTCAGTGAGCGGAGTCTGAGGTCGCTGTGGA
RBd19C06 pGCAP10 GAGACTGAATTGTCAGTGAGCGGAGTCTGAGGTCGCTGTGGACTGCCCACTGGGCCTTGC
RBd48D03 pGCAP10 GGGTTCCCAGACTGAATTGTCAGTGAGCGGAGTCTGAGGTCGCTGTGGACTGCCCACTGG
RBd49A04 pGCAP10 GGAGTCTGAGGTCGCTGTGGACTGCCCACTGGATTGTGAAAAATGAGGTCCTCTTTCTAG
RBdS014E09 pGCAP10 GGAATTGTCAGTGAGCGGAGTCTGAGGTCGCTGTGGACTGCCCACTGGGCCTTGCCCGAG
RBdS014K03 pGCAP10 GGAATTGTCAGTGAGCGGAGTCTGAGGTCGCTGTGGACTGCCCACTGGGCCTTGCCCGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl