Prev. | 

RIKEN DNA Bank Human Resource - PDZD11

Gene ID NCBI Gene 51248 |  KEGG hsa:51248
Gene Symbol PDZD11
Protein Name PDZ domain containing 11
Synonyms AIPP1|PDZK11|PISP
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084423 IRAL011A23 pOTB7 BC012996 NM_016484 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR064007 ARe60A07 pKA1U5 NM_016484.4  
GATCCGCTTCCGGTTCCCAGACTGAATTGTCAGTGAGCGGAGTCTGAGGTCGCTGTGGAC
HKR336829 RBb42B05 pGCAP1 NM_016484.4  
GCATCCGCTTCCGGTTCCCAGACTGAATTGTCAGTGAGCGGAGTCTGAGGTCGCTGTGGA
HKR367654 RBd19C06 pGCAP10 NM_016484.4  
GAGACTGAATTGTCAGTGAGCGGAGTCTGAGGTCGCTGTGGACTGCCCACTGGGCCTTGC
HKR379275 RBd48D03 pGCAP10 NM_016484.4  
GGGTTCCCAGACTGAATTGTCAGTGAGCGGAGTCTGAGGTCGCTGTGGACTGCCCACTGG
HKR379604 RBd49A04 pGCAP10 NM_016484.4  
GGAGTCTGAGGTCGCTGTGGACTGCCCACTGGATTGTGAAAAATGAGGTCCTCTTTCTAG
HKR405705 RBdS014E09 pGCAP10 NM_016484.4  
GGAATTGTCAGTGAGCGGAGTCTGAGGTCGCTGTGGACTGCCCACTGGGCCTTGCCCGAG
HKR405843 RBdS014K03 pGCAP10 NM_016484.4  
GGAATTGTCAGTGAGCGGAGTCTGAGGTCGCTGTGGACTGCCCACTGGGCCTTGCCCGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl