Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10580

HP ID(1) HP10580
Gene ID(2) 80700
Gene Symbol finder UBXN6
Protein Name UBX domain protein 6
RefSeq NM_025241.1
Length of RefSeq (bp) 1656
Chromosome 19p13
Reference DDBJ accession
UniGene Hs.435255

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd51B11 pGCAP10 GATTTTCTTCCGGTGGCTGGTCTCCGGCGGCCCCGTCCCCGACTGGGCCCCGTGCCCCAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl