Prev. |  KEGG KO K14011 > 

RIKEN DNA Bank Human Resource - UBXN6

Gene ID NCBI Gene 80700 |  KEGG hsa:80700
Gene Symbol UBXN6
Protein Name UBX domain protein 6
Synonyms UBXD1|UBXDC2
Ortholog resources KEGG ortholog (KEGG orthology K14011) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081261 IRAL003C13 pOTB7 BC007414 NM_025241 Partial
HGY085488 IRAL013L24 pOTB7 BC008288 NM_025241 Partial/var
HGY089568 IRAL023P08 pOTB7 BC017113 NM_025241 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR380435 RBd51B11 pGCAP10 NM_025241.1  
GATTTTCTTCCGGTGGCTGGTCTCCGGCGGCCCCGTCCCCGACTGGGCCCCGTGCCCCAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl