Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10567

HP ID(1) HP10567
Gene ID(2) 23595
Gene Symbol finder ORC3L
Protein Name origin recognition complex, subunit 3-like (yeast)
RefSeq NM_181837.1
Length of RefSeq (bp) 2528
Chromosome 6q14.3-q16.1
Reference DDBJ accession
UniGene Hs.410228

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe01H09 pKA1U5 GGGGAAATCCCGAGTGCATCTGGAATACGCAGAGTCNGTAAGACCATGGCTACGTCCTCG
RBd09G02 pGCAP10 GCTGGAATACGCAGAGTCAGTAAGACCATGGCTACGTCCTCGATGTCTAAGGGTTGCTTT
RBd34B06 pGCAP10 GGGGAAATCCCGAGTGCATCTGGAATACGCAGAGTCAGTAAGACCATGGCTACGTCCTCG
RBdS105B04 pGCAP10 GGCATCTGGAATACGCAGAGTCAGTAAGACCATGGCTACGTCCTCGATGTCTAAGGGTTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl