Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS105B04

Clone ID RBdS105B04
HP ID HP10567
Gene ID 23595
Gene Symbol ORC3L
Protein Name origin recognition complex, subunit 3-like (yeast)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_181837.1
Length of RefSeq (bp) 2528
Chromosome 6q14.3-q16.1
Reference DDBJ accession
UniGene Hs.410228
5'-terminal sequence GGCATCTGGAATACGCAGAGTCAGTAAGACCATGGCTACGTCCTCGATGTCTAAGGGTTG
2011.08.28