Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10551

HP ID(1) HP10551
Gene ID(2) 9200
Gene Symbol finder PTPLA
Protein Name protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A
RefSeq NM_014241.3
Length of RefSeq (bp) 1323
Chromosome 10p14-p13
Reference DDBJ accession
UniGene Hs.114062

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe71D03 pKA1U5 GGCACATGGGGCGCCTGACGGAAGCGGCGGCAGCGGGCAGCGGCTCTCGGGCTGCAGGCT
ARe77E08 pKA1U5 GGGGGCGCCTGACGGAAGCGGCGGCAGCGGGCCGCNTTNATCTCGGGCTGCAGGCTGGGC
ARi24D07 pGCAP10 GGAGCTGGCTGCGCCGAGCCCCCTGCGCGCTGCACATGGGGCGCCTGACGGAAGCG
ARiS013C13 pGCAP10 GAGAGCTGGNTGCNCCNANCCCCCTGCGCGCTGCACATGGGGCGCCTGACGGAAGCGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl