Prev. |  KEGG KO K10703 > 

RIKEN DNA Bank Human Resource - HACD1

Gene ID NCBI Gene 9200 |  KEGG hsa:9200
Gene Symbol HACD1
Protein Name 3-hydroxyacyl-CoA dehydratase 1
Synonyms CAP|PTPLA
Ortholog resources KEGG ortholog (KEGG orthology K10703) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087914 IRAL019N02 pDNR-LIB BC010353 NM_014241 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR068475 ARe71D03 pKA1U5 NM_014241.3  
GGCACATGGGGCGCCTGACGGAAGCGGCGGCAGCGGGCAGCGGCTCTCGGGCTGCAGGCT
HKR070904 ARe77E08 pKA1U5 NM_014241.3  
GGGGGCGCCTGACGGAAGCGGCGGCAGCGGGCCGCNTTNATCTCGGGCTGCAGGCTGGGC
HKR169679 ARi24D07 pGCAP10 NM_014241.3  
GGAGCTGGCTGCGCCGAGCCCCCTGCGCGCTGCACATGGGGCGCCTGACGGAAGCG
HKR205261 ARiS013C13 pGCAP10 NM_014241.3  
GAGAGCTGGNTGCNCCNANCCCCCTGCGCGCTGCACATGGGGCGCCTGACGGAAGCGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl