Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10534

HP ID(1) HP10534
Gene ID(2) 100128731
Gene Symbol finder OST4
Protein Name OST4 oligosaccharyltransferase 4 homolog (S. cerevisiae)
RefSeq NM_001134693.1
Length of RefSeq (bp) 509
Chromosome 2p23.3
Reference DDBJ accession
UniGene Hs.502948

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe03E09 pKA1U5 AB371465 GCCAGGTCTCTGACTTCGGGCTTGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCA
ARe37D02 pKA1U5 GGACTTCGGGCTTGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCAGGATGATCAC
ARe47F06 pKA1U5 GCTCTGACTTCGGGCTTGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCAGGATGA
ARe50E03 pKA1U5 GGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCAGGATGATCACGGACGTGCAGCT
ARe58C11 pKA1U5 GGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCAGGATGATCACGGACGTGCAGCT
ARe73G10 pKA1U5 GGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACCGGTNAGGATGATCACGGACGTGCAGCT
ARf01B06 pKA1U5 GCTCTGACTTCGGGCTTGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCAGGATGA
ARi05D02 pGCAP10 GGGGCTTGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCAGGATGATCACGGACGT
ARi27H01 pGCAP10 GGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCAGGATGATCACGGACGTGCAGCT
ARi29D05 pGCAP10 GCTCTGACTTCGGGCTTGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCAGGATGA
ARi40G12 pGCAP10 GCTCTGACTTCGGGCTTGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCAGGATGA
ARiS020F07 pGCAP10 GGGGCTTGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCAGGATGATCACGGACGT
ARiS020H14 pGCAP10 GGGAGCCGAGCCGGACTGGTCAGGATGATCACGGACGTGCAGCTCGCCATCTTCGCCAAC
ARiS049H07 pGCAP10 GGGGCTTGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCAGGATGATCACGGACGT
ARiS087F24 pGCAP10 GGNCTCNGNCNTCGGGCNNGNNNGCTGGNGGCGTCGGAGCCNAGCCGGACTGGTCAGGAT
ARiS088D05 pGCAP10 CGGCCGGCCGATGAGTTCCGGTCCAGGTCTCTGACTTCGGGCTTGTTCGCTGGTGGCGTC
ARiS109B19 pGCAP10 GGGAGCCGAGCCGGACTGGTCAGGATGATCACGGACGTGCAGCTCGCCATCTTCGCCAAC
ARiS118C16 pGCAP10 GGGGCTTGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCAGGATGATCACGGACGT
RBb45G06 pGCAP1 ACGCTTCGGGCTTGTTCGCTGGTGGCGTGGGAGCCGAGCCGGACTGGTCAGGATGATCAC
RBb53F05 pGCAP1 GCCAGGTCTCTGACTTCGGGCTTGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCA
RBdS051E19 pGCAP10 GCCAGGTCTCTGACTTCGGGCTTGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCA
RBdS083L02 pGCAP10 AAGTTCCGGTCCAGGTCTCTGACTTCGGGCTTGTTCGCTGGTGGCGTCGGAGCCGAGCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl