Prev. | 

RIKEN DNA Bank Human Resource - OST4

Gene ID NCBI Gene 100128731 |  KEGG hsa:100128731
Gene Symbol OST4
Protein Name oligosaccharyltransferase complex subunit 4, non-catalytic
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041305 ARe03E09 pKA1U5 NM_001134693.1 done
GCCAGGTCTCTGACTTCGGGCTTGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCA
HKR054874 ARe37D02 pKA1U5 NM_001134693.1  
GGACTTCGGGCTTGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCAGGATGATCAC
HKR058926 ARe47F06 pKA1U5 NM_001134693.1  
GCTCTGACTTCGGGCTTGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCAGGATGA
HKR060099 ARe50E03 pKA1U5 NM_001134693.1  
GGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCAGGATGATCACGGACGTGCAGCT
HKR063259 ARe58C11 pKA1U5 NM_001134693.1  
GGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCAGGATGATCACGGACGTGCAGCT
HKR069354 ARe73G10 pKA1U5 NM_001134693.1  
GGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACCGGTNAGGATGATCACGGACGTGCAGCT
HKR080430 ARf01B06 pKA1U5 NM_001134693.1  
GCTCTGACTTCGGGCTTGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCAGGATGA
HKR162074 ARi05D02 pGCAP10 NM_001134693.1  
GGGGCTTGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCAGGATGATCACGGACGT
HKR170969 ARi27H01 pGCAP10 NM_001134693.1  
GGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCAGGATGATCACGGACGTGCAGCT
HKR171677 ARi29D05 pGCAP10 NM_001134693.1  
GCTCTGACTTCGGGCTTGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCAGGATGA
HKR176156 ARi40G12 pGCAP10 NM_001134693.1  
GCTCTGACTTCGGGCTTGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCAGGATGA
HKR208127 ARiS020F07 pGCAP10 NM_001134693.1  
GGGGCTTGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCAGGATGATCACGGACGT
HKR208182 ARiS020H14 pGCAP10 NM_001134693.1  
GGGAGCCGAGCCGGACTGGTCAGGATGATCACGGACGTGCAGCTCGCCATCTTCGCCAAC
HKR219775 ARiS049H07 pGCAP10 NM_001134693.1  
GGGGCTTGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCAGGATGATCACGGACGT
HKR234944 ARiS087F24 pGCAP10 NM_001134693.1  
GGNCTCNGNCNTCGGGCNNGNNNGCTGGNGGCGTCGGAGCCNAGCCGGACTGGTCAGGAT
HKR235277 ARiS088D05 pGCAP10 NM_001134693.1  
CGGCCGGCCGATGAGTTCCGGTCCAGGTCTCTGACTTCGGGCTTGTTCGCTGGTGGCGTC
HKR243643 ARiS109B19 pGCAP10 NM_001134693.1  
GGGAGCCGAGCCGGACTGGTCAGGATGATCACGGACGTGCAGCTCGCCATCTTCGCCAAC
HKR247264 ARiS118C16 pGCAP10 NM_001134693.1  
GGGGCTTGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCAGGATGATCACGGACGT
HKR338150 RBb45G06 pGCAP1 NM_001134693.1  
ACGCTTCGGGCTTGTTCGCTGGTGGCGTGGGAGCCGAGCCGGACTGGTCAGGATGATCAC
HKR341325 RBb53F05 pGCAP1 NM_001134693.1  
GCCAGGTCTCTGACTTCGGGCTTGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCA
HKR420515 RBdS051E19 pGCAP10 NM_001134693.1  
GCCAGGTCTCTGACTTCGGGCTTGTTCGCTGGTGGCGTCGGAGCCGAGCCGGACTGGTCA
HKR433466 RBdS083L02 pGCAP10 NM_001134693.1  
AAGTTCCGGTCCAGGTCTCTGACTTCGGGCTTGTTCGCTGGTGGCGTCGGAGCCGAGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl