Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10512

HP ID(1) HP10512
Gene ID(2) 55845
Gene Symbol finder C3orf10
Protein Name chromosome 3 open reading frame 10
RefSeq NM_018462.4
Length of RefSeq (bp) 1197
Chromosome 3p25.3
Reference DDBJ accession
UniGene Hs.649307

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe42E11 pKA1U5 GGCTCTTCCTCAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGGGAGATTCA
ARe48E10 pKA1U5 GGCTCTTCCTCAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGGGAGATTCA
ARe54C08 pKA1U5 GGCTCTTCCTCAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGGGAGATTCA
ARe86E11 pKA1U5 GCTTCCTCAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGGGAGATTCACCA
ARe88E11 pKA1U5 GCTCAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGGGAGATTCACCAGGAC
ARi55E07 pGCAP10 GGCTCTTCCTCAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGGGAGATTCA
ARi61B09 pGCAP10 GGCAGTCGCTCTTCCTCAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGGGA
ARi68C04 pGCAP10 GTCCTCAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGGGAGATTCACCAGG
ARiS085N09 pGCAP10 GCTTCCTCAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGGGAGATTCACCA
ARiS087M18 pGCAP10 GAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGGGAGATTCACCAGGACTGG
ARiS194L04 pGCAP10 GGCAGTCGCTCTTCCTCAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGGGA
RBb42B11 pGCAP1 GGCGCAGTCGCTCTTCCTCAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGG
RBd42G12 pGCAP10 GCTTCCTCAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGGGAGATTCACCA
RBd43H12 pGCAP10 GGCAGTCGCTCTTCCTCAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl