Prev. |  KEGG KO K05752 > 

RIKEN DNA Bank Human Resource - BRK1

Gene ID NCBI Gene 55845 |  KEGG hsa:55845
Gene Symbol BRK1
Protein Name BRICK1 subunit of SCAR/WAVE actin nucleating complex
Synonyms C3orf10|HSPC300|MDS027|hHBrk1
Ortholog resources KEGG ortholog (KEGG orthology K05752) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056601 IRAK141I09 pCMV-SPORT6 BC061515 NM_018462 Full
HGY080933 IRAL002F13 pOTB7 BC001067 NM_018462 Full
HGY083702 IRAL009E06 pOTB7 BC019303 NM_018462 Full
HGY088048 IRAL020B24 pOTB7 BC007929 NM_018462 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR056907 ARe42E11 pKA1U5 NM_018462.4  
GGCTCTTCCTCAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGGGAGATTCA
HKR059306 ARe48E10 pKA1U5 NM_018462.4  
GGCTCTTCCTCAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGGGAGATTCA
HKR061656 ARe54C08 pKA1U5 NM_018462.4  
GGCTCTTCCTCAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGGGAGATTCA
HKR074507 ARe86E11 pKA1U5 NM_018462.4  
GCTTCCTCAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGGGAGATTCACCA
HKR075307 ARe88E11 pKA1U5 NM_018462.4  
GCTCAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGGGAGATTCACCAGGAC
HKR182103 ARi55E07 pGCAP10 NM_018462.4  
GGCTCTTCCTCAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGGGAGATTCA
HKR184433 ARi61B09 pGCAP10 NM_018462.4  
GGCAGTCGCTCTTCCTCAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGGGA
HKR187252 ARi68C04 pGCAP10 NM_018462.4  
GTCCTCAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGGGAGATTCACCAGG
HKR234321 ARiS085N09 pGCAP10 NM_018462.4  
GCTTCCTCAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGGGAGATTCACCA
HKR235106 ARiS087M18 pGCAP10 NM_018462.4  
GAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGGGAGATTCACCAGGACTGG
HKR277868 ARiS194L04 pGCAP10 NM_018462.4  
GGCAGTCGCTCTTCCTCAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGGGA
HKR336835 RBb42B11 pGCAP1 NM_018462.4  
GGCGCAGTCGCTCTTCCTCAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGG
HKR376956 RBd42G12 pGCAP10 NM_018462.4  
GCTTCCTCAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGGGAGATTCACCA
HKR377380 RBd43H12 pGCAP10 NM_018462.4  
GGCAGTCGCTCTTCCTCAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl