Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10493

HP ID(1) HP10493
Gene ID(2) 11098
Gene Symbol finder PRSS23
Protein Name protease, serine, 23
RefSeq NM_007173.4
Length of RefSeq (bp) 3806
Chromosome 11q14.1
Reference DDBJ accession
UniGene Hs.25338

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe08B10 pKA1U5 GACTCGGCTGTGCGGCGGGGCAGGCATGGGAGCCGCGCGCTCTCTCCCGGCGCCCACACC
ARe55C03 pKA1U5 GGCACTCGGCTGTGCGGCGGGGCAGGCATGGGCAGCCGCGCGCTCTCTCCCGGCGCCCAC
ARe65G02 pKA1U5 GACTCGGCTGTGCGGCGGGGCAAGCATGGGAGCCTCGCGCTCTCTCCCGGCGCCCACACC
ARe71D08 pKA1U5 GGCACTCGGCTGTGCGGCGGGGCAGGCATGGGAGCCGCGCGCTCTCTCCCGGCGCCCACA
ARf01G08 pKA1U5 GGGCTGTGCGGCGGGGCAGGCATGGGAGCCGCGCGCTCTCTCCCGGCGCCCACACCTGTC
ARf03B06 pKA1U5 GGCACTCGGTCTGTGCGGCGGGGCAGGCATGGGAGCCGCGCGCTCTCTCCCGGACGCCCA
ARf03C11 pKA1U5 GGNACTCGGCTGTGCGGCGGGGCAGGCATGGGANCCNNNCGCTCTCTCCCGGAGCCCACA
ARi05D07 pGCAP10 GACTCGGCTGTGCGGCGGGGCAGGCATGGGAGCCGCGCGCTCTCTCCCGGCGCCCACACC
ARi44E05 pGCAP10 GACTCGGCTGTGCGGCGGGGCAGGCATGGGAGCCGCGCGCTCTCTCCCGGCGCCCACACC
ARi66C03 pGCAP10 GATGGGAGCCGCGCGCTCTCTCCCGGCGCCCACACCTGTCTGAGCGGCGCAGCGAGCCGC
ARiS045E01 pGCAP10 CGGCCGGCCGATGACTCGGCTGTGCGGCGGGGCAGGCATGGGAGCCGCGCGCTCTCTCCC
ARiS109N02 pGCAP10 GTCGGCTGTGCGGCGGGGCAGGCATGGGAGCCGCGCGCTCTCTCCCGGCGCCCACACCTG
ARiS150L23 pGCAP10 GACTCGGCTGTGCGGCGGGGCAGGCATGGGAGCCGCGCGCTCTCTCCCGGCGCCCACACC
ARiS150P04 pGCAP10 GACTCGGCTGTGCGGCGGGGCAGGCATGGGAGCCGCGCGCTCTCTCCCGGCGCCCACACC
ARiS198C17 pGCAP10 GGCGGCTTCCCCGAGGCCGGAGGCGGGGCGGGCGGGCCTCGGGTGGCGCGGGGGGCGGAC
RBdS154G04 pGCAP10 GACTCGGCTGTGCGGCGGGGCAGGCATGGGAGCCGCGCGCTCTCTCCCGGCGCCCACACC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl