Prev. |  KEGG KO K09627 > 

RIKEN DNA Bank Human Resource - PRSS23

Gene ID NCBI Gene 11098 |  KEGG hsa:11098
Gene Symbol PRSS23
Protein Name protease, serine 23
Synonyms SIG13|SPUVE|ZSIG13
Ortholog resources KEGG ortholog (KEGG orthology K09627) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001954 IRAK004O18 pCMV-SPORT6 BC001278 NM_007173 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043234 ARe08B10 pKA1U5 NM_007173.4  
GACTCGGCTGTGCGGCGGGGCAGGCATGGGAGCCGCGCGCTCTCTCCCGGCGCCCACACC
HKR062051 ARe55C03 pKA1U5 NM_007173.4  
GGCACTCGGCTGTGCGGCGGGGCAGGCATGGGCAGCCGCGCGCTCTCTCCCGGCGCCCAC
HKR066146 ARe65G02 pKA1U5 NM_007173.4  
GACTCGGCTGTGCGGCGGGGCAAGCATGGGAGCCTCGCGCTCTCTCCCGGCGCCCACACC
HKR068480 ARe71D08 pKA1U5 NM_007173.4  
GGCACTCGGCTGTGCGGCGGGGCAGGCATGGGAGCCGCGCGCTCTCTCCCGGCGCCCACA
HKR080552 ARf01G08 pKA1U5 NM_007173.4  
GGGCTGTGCGGCGGGGCAGGCATGGGAGCCGCGCGCTCTCTCCCGGCGCCCACACCTGTC
HKR081230 ARf03B06 pKA1U5 NM_007173.4  
GGCACTCGGTCTGTGCGGCGGGGCAGGCATGGGAGCCGCGCGCTCTCTCCCGGACGCCCA
HKR081259 ARf03C11 pKA1U5 NM_007173.4  
GGNACTCGGCTGTGCGGCGGGGCAGGCATGGGANCCNNNCGCTCTCTCCCGGAGCCCACA
HKR162079 ARi05D07 pGCAP10 NM_007173.4  
GACTCGGCTGTGCGGCGGGGCAGGCATGGGAGCCGCGCGCTCTCTCCCGGCGCCCACACC
HKR177701 ARi44E05 pGCAP10 NM_007173.4  
GACTCGGCTGTGCGGCGGGGCAGGCATGGGAGCCGCGCGCTCTCTCCCGGCGCCCACACC
HKR186451 ARi66C03 pGCAP10 NM_007173.4  
GATGGGAGCCGCGCGCTCTCTCCCGGCGCCCACACCTGTCTGAGCGGCGCAGCGAGCCGC
HKR218097 ARiS045E01 pGCAP10 NM_007173.4  
CGGCCGGCCGATGACTCGGCTGTGCGGCGGGGCAGGCATGGGAGCCGCGCGCTCTCTCCC
HKR243914 ARiS109N02 pGCAP10 NM_007173.4  
GTCGGCTGTGCGGCGGGGCAGGCATGGGAGCCGCGCGCTCTCTCCCGGCGCCCACACCTG
HKR260287 ARiS150L23 pGCAP10 NM_007173.4  
GACTCGGCTGTGCGGCGGGGCAGGCATGGGAGCCGCGCGCTCTCTCCCGGCGCCCACACC
HKR260364 ARiS150P04 pGCAP10 NM_007173.4  
GACTCGGCTGTGCGGCGGGGCAGGCATGGGAGCCGCGCGCTCTCTCCCGGCGCCCACACC
HKR279265 ARiS198C17 pGCAP10 NM_007173.4  
GGCGGCTTCCCCGAGGCCGGAGGCGGGGCGGGCGGGCCTCGGGTGGCGCGGGGGGCGGAC
HKR461748 RBdS154G04 pGCAP10 NM_007173.4  
GACTCGGCTGTGCGGCGGGGCAGGCATGGGAGCCGCGCGCTCTCTCCCGGCGCCCACACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl