Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10492

HP ID(1) HP10492
Gene ID(2) 10528
Gene Symbol finder NOL5A
Protein Name nucleolar protein 5A (56kDa with KKE/D repeat)
RefSeq NM_006392.2
Length of RefSeq (bp) 1992
Chromosome 20p13
Reference DDBJ accession
UniGene Hs.376064

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe75G10 pKA1U5 GATTGCGAGCCGAACCCGGCAGCTGGCGCCATGNCTGCTGTTGCACGTGCTGTTTGAGCA
ARi36A12 pGCAP10 GGCATTGCGAGCCGAACCCGGGAGCTGGCGCCATGGTGCTGTTGCACGTGCTGTTTGAGC
RBb17B03 pKA1U5 GATTGCGAGCCGAACCCGGGAGCTGGCGCCATGGTGCTGTTGCACGTGCTGTTTGAGCAC
RBb20C06 pKA1U5 TCCCTGACCTATACAGGCCTCTGCTATGGGGGTGATGGCCAGTCCTGGTGTCTGAGTGAT
RBd10E09 pGCAP10 CGGCCGGCCGATGATTGCGAGCCGAACCCGGGAGCTGGCGCCATGGTGCTGTTGCACGTG
RBd30C09 pGCAP10 CGGCCGGCCGATAATTAAACTATCCCAGAAACACTGGGCAATGTTAACGACACGCGTTCC
RBdS013I24 pGCAP10 ATCACGGTGATGGCTGACCAGGGCTCCCTGACCTATACAGGCCTCTGCTATGGGGGTGAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl