Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NOP56

Gene ID (NCBI) 10528
Gene Symbol NOP56
Protein Name NOP56 ribonucleoprotein
Synonyms NOL5A|SCA36
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX020725 IRAK051N13 pCMV-SPORT6 BC035369 NM_006392 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR174412 ARi36A12 pGCAP10 NM_006392.2
GGCATTGCGAGCCGAACCCGGGAGCTGGCGCCATGGTGCTGTTGCACGTGCTGTTTGAGC
HKR070154 ARe75G10 pKA1U5 NM_006392.2
GATTGCGAGCCGAACCCGGCAGCTGGCGCCATGNCTGCTGTTGCACGTGCTGTTTGAGCA
HKR326827 RBb17B03 pKA1U5 NM_006392.2
GATTGCGAGCCGAACCCGGGAGCTGGCGCCATGGTGCTGTTGCACGTGCTGTTTGAGCAC
HKR364105 RBd10E09 pGCAP10 NM_006392.2
CGGCCGGCCGATGATTGCGAGCCGAACCCGGGAGCTGGCGCCATGGTGCTGTTGCACGTG
HKR328054 RBb20C06 pKA1U5 NM_006392.2
TCCCTGACCTATACAGGCCTCTGCTATGGGGGTGATGGCCAGTCCTGGTGTCTGAGTGAT
HKR372057 RBd30C09 pGCAP10 NM_006392.2
CGGCCGGCCGATAATTAAACTATCCCAGAAACACTGGGCAATGTTAACGACACGCGTTCC
HKR405416 RBdS013I24 pGCAP10 NM_006392.2
ATCACGGTGATGGCTGACCAGGGCTCCCTGACCTATACAGGCCTCTGCTATGGGGGTGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.04

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl