Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10481

HP ID(1) HP10481
Gene ID(2) 10329
Gene Symbol finder TMEM5
Protein Name transmembrane protein 5
RefSeq NM_014254.1
Length of RefSeq (bp) 1451
Chromosome 12q14.2
Reference DDBJ accession
UniGene Hs.216386

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi19F07 pGCAP10 GGCCTGGAAACGGGCTGGGCCTGCCTCGGACGCCGCCGGTGTCGCGGATTCTCTTTCCGC
RBb46H06 pGCAP1 GACGGGCTGGGCCTGCCTCGGACGCCGCCGGTGTCGCGGATTCTCTTTCCGCCCGCTCCA
RBdS015O18 pGCAP10 TGGCCTGGAAACGGGCTGGGCCTGCCTCGGACGCCGCCGGTGTCGCGGATTCTCTTTCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl