Prev. |  KEGG KO K21052 > 

RIKEN DNA Bank Human Resource - RXYLT1

Gene ID NCBI Gene 10329 |  KEGG hsa:10329
Gene Symbol RXYLT1
Protein Name ribitol xylosyltransferase 1
Synonyms HP10481|MDDGA10|TMEM5
Ortholog resource in our bank

  RXYLT1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010457 IRAK026C09 pCMV-SPORT6 BC013152 NM_014254 Full
HGY081820 IRAL004J04 pOTB7 BC002596 NM_014254 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR167727 ARi19F07 pGCAP10 NM_014254.1  
GGCCTGGAAACGGGCTGGGCCTGCCTCGGACGCCGCCGGTGTCGCGGATTCTCTTTCCGC
HKR338574 RBb46H06 pGCAP1 NM_014254.1  
GACGGGCTGGGCCTGCCTCGGACGCCGCCGGTGTCGCGGATTCTCTTTCCGCCCGCTCCA
HKR406354 RBdS015O18 pGCAP10 NM_014254.1  
TGGCCTGGAAACGGGCTGGGCCTGCCTCGGACGCCGCCGGTGTCGCGGATTCTCTTTCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl