Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10474

HP ID(1) HP10474
Gene ID(2) 401152
Gene Symbol finder C4orf3
Protein Name chromosome 4 open reading frame 3
RefSeq NM_001001701.3
Length of RefSeq (bp) 2854
Chromosome 4q26
Reference DDBJ accession
UniGene Hs.718451

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe23E08 pKA1U5 GGCAGGAGCGAGATGGAGGTGGACGCACCGGGCTGTTGATGGTCGAGATGGTCTCCGGGA
ARe24C10 pKA1U5 GGGTGCGGCGAACACCAAAGTCCGGGAACTTAAGCATTTTCGGTTTCTAGGGTTGTTACG
ARe50D09 pKA1U5 GGAGCCAGGCGCCTGCGCGCTGGGAAGAGTAGGTTCAGAGTGCATTCCGGAACCCGGGGC
ARe84C12 pKA1U5 GGCACTGCGCAGGCGGCCGGACTCCGCTCAGTTTCCGGTGCGGCGAACACCAAAGTCCGG
ARe86A02 pKA1U5 ATCCTGGGCACTGCGCAGGCGGCCGGACTCCGCTCAGTTTCCGGTGCGGCGAACACCAAA
ARe91E05 pKA1U5 GGGTTTCTAGGGTTGTTACGAAGCTGCAGGAGCGAGATGGAGGTGGACGCACCGGGTGTT
ARe94C06 pKA1U5 GGCACTGCCGCAGGCGGCCGGGACTCCGCTCAGGTTTCCGGTGCGGCGAACACCAAAGTC
ARi48E10 pGCAP10 CGGCCGGCCGATACGAAGCTGCAGGAGCGAGATGGAGGTGGACGCACCGGGTGTTGATGG
ARiS049O01 pGCAP10 GACTCCGCTCAGTTTCCGGTGCGGCGAACACCAAAGTCCGGGAACTTAAGCATTTTCGGT
ARiS085B17 pGCAP10 GGCTCAGTTTCCGGTGCGGCGAACACCAAAGTCCGGGAACTTAAGCATTTTCGGTTTCTA
RBb08G04 pKA1U5 TGGGCCGGACTCCGCTCAGTTTCCGGTGCGGCGAACACCAAAGTCCGGGAACTTAAGCAT
RBd29F05 pGCAP10 GTTCCGGTGCGGCGAACACCAAAGTCCGGGAACTTAAGCATTTTCGGTTTCTAGGGTTGT
RBd95F09 pGCAP10 GGCCGGACTCCGCTCAGTTTCCGGTGCGGCGAACACCAAAGTCCGGGAACTTAAGCATTT
RBdS040I23 pGCAP10 TGACTCCGCTCAGTTTCCGGTGCGGCGAACACCAAAGTCCGGGAACTTAAGCATTTTCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl