Prev. | 

RIKEN DNA Bank Human Resource - C4orf3

Gene ID NCBI Gene 401152 |  KEGG hsa:401152
Gene Symbol C4orf3
Protein Name chromosome 4 open reading frame 3
Synonyms ALN|HCVFTP1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY092848 IRAL032B24 pDNR-LIB BC017399 NM_001001701 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049304 ARe23E08 pKA1U5 NM_001001701.3  
GGCAGGAGCGAGATGGAGGTGGACGCACCGGGCTGTTGATGGTCGAGATGGTCTCCGGGA
HKR049658 ARe24C10 pKA1U5 NM_001001701.3  
GGGTGCGGCGAACACCAAAGTCCGGGAACTTAAGCATTTTCGGTTTCTAGGGTTGTTACG
HKR060081 ARe50D09 pKA1U5 NM_001001701.3  
GGAGCCAGGCGCCTGCGCGCTGGGAAGAGTAGGTTCAGAGTGCATTCCGGAACCCGGGGC
HKR073660 ARe84C12 pKA1U5 NM_001001701.3  
GGCACTGCGCAGGCGGCCGGACTCCGCTCAGTTTCCGGTGCGGCGAACACCAAAGTCCGG
HKR074402 ARe86A02 pKA1U5 NM_001001701.3  
ATCCTGGGCACTGCGCAGGCGGCCGGACTCCGCTCAGTTTCCGGTGCGGCGAACACCAAA
HKR076501 ARe91E05 pKA1U5 NM_001001701.3  
GGGTTTCTAGGGTTGTTACGAAGCTGCAGGAGCGAGATGGAGGTGGACGCACCGGGTGTT
HKR077654 ARe94C06 pKA1U5 NM_001001701.3  
GGCACTGCCGCAGGCGGCCGGGACTCCGCTCAGGTTTCCGGTGCGGCGAACACCAAAGTC
HKR179306 ARi48E10 pGCAP10 NM_001001701.3  
CGGCCGGCCGATACGAAGCTGCAGGAGCGAGATGGAGGTGGACGCACCGGGTGTTGATGG
HKR219937 ARiS049O01 pGCAP10 NM_001001701.3  
GACTCCGCTCAGTTTCCGGTGCGGCGAACACCAAAGTCCGGGAACTTAAGCATTTTCGGT
HKR234041 ARiS085B17 pGCAP10 NM_001001701.3  
GGCTCAGTTTCCGGTGCGGCGAACACCAAAGTCCGGGAACTTAAGCATTTTCGGTTTCTA
HKR323348 RBb08G04 pKA1U5 NM_001001701.3  
TGGGCCGGACTCCGCTCAGTTTCCGGTGCGGCGAACACCAAAGTCCGGGAACTTAAGCAT
HKR371725 RBd29F05 pGCAP10 NM_001001701.3  
GTTCCGGTGCGGCGAACACCAAAGTCCGGGAACTTAAGCATTTTCGGTTTCTAGGGTTGT
HKR398129 RBd95F09 pGCAP10 NM_001001701.3  
GGCCGGACTCCGCTCAGTTTCCGGTGCGGCGAACACCAAAGTCCGGGAACTTAAGCATTT
HKR416215 RBdS040I23 pGCAP10 NM_001001701.3  
TGACTCCGCTCAGTTTCCGGTGCGGCGAACACCAAAGTCCGGGAACTTAAGCATTTTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl