Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10448

HP ID(1) HP10448
Gene ID(2) 29105
Gene Symbol finder C16orf80
Protein Name chromosome 16 open reading frame 80
RefSeq NM_013242.2
Length of RefSeq (bp) 1308
Chromosome 16q21
Reference DDBJ accession
UniGene Hs.532755

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi28C01 pGCAP10 GGGGGAAATACCGCGGCGCGGACGGTAGTTGCTGTGGTTTCCGTTCTGAGCTCGCAGCTT
ARiS118P03 pGCAP10 GGCTCGCAGCTTAGGAGCTGAAGATCGCGGACTTAGCGTTGCCGCGTCCGAGTCCGGCCA
RBb30D02 pGCAP1 GGCTGAAGATCGCGGACTTAGCGTTCCCGCGTCCGAGTCCGGCCATCAGTGGCTGCAGAT
RBdS007G04 pGCAP10 GGGTAGTTGCTGTGGTTTCCGTTCTGAGCTCGCAGCTTAGGAGCTGAAGATCGCGGACTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl