Prev. | 

RIKEN DNA Bank Human Resource - CFAP20

Gene ID NCBI Gene 29105 |  KEGG hsa:29105
Gene Symbol CFAP20
Protein Name cilia and flagella associated protein 20
Synonyms BUG22|C16orf80|EVORF|GTL3|fSAP23
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084603 IRAL011I11 pOTB7 BC005152 NM_013242 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR171249 ARi28C01 pGCAP10 NM_013242.2  
GGGGGAAATACCGCGGCGCGGACGGTAGTTGCTGTGGTTTCCGTTCTGAGCTCGCAGCTT
HKR247563 ARiS118P03 pGCAP10 NM_013242.2  
GGCTCGCAGCTTAGGAGCTGAAGATCGCGGACTTAGCGTTGCCGCGTCCGAGTCCGGCCA
HKR332074 RBb30D02 pGCAP1 NM_013242.2  
GGCTGAAGATCGCGGACTTAGCGTTCCCGCGTCCGAGTCCGGCCATCAGTGGCTGCAGAT
HKR402948 RBdS007G04 pGCAP10 NM_013242.2  
GGGTAGTTGCTGTGGTTTCCGTTCTGAGCTCGCAGCTTAGGAGCTGAAGATCGCGGACTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl