Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10447

HP ID(1) HP10447
Gene ID(2) 374882
Gene Symbol finder TMEM205
Protein Name transmembrane protein 205
RefSeq NM_198536.1
Length of RefSeq (bp) 1066
Chromosome 19p13.2
Reference DDBJ accession
UniGene Hs.8036

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb01H07 pKA1U5 AGCTGGGAGGCGGGACGAATTATTGGTTGGGGGAAACCCACGAGGGGACGCGGCCGAGGA
RBd21B01 pGCAP10 GGAAACCCACGAGGGGACGCGGCCGAGGAGGGTCGCTGTCCACCCGGGGGCGTGGGAGTG
RBd82D01 pGCAP10 GATTGGTTGGGGGAAACCCACGAGGGGACGCGGCCGAGGAGGGTCGCTGTCCACCCGGGG
RBd99F12 pGCAP10 GAGCTGGGAGGCGGGACGAATTATTGGTTGGGGGAAACCCACGAGGGGACGCGGCCGAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl