Prev. | 

RIKEN DNA Bank Human Resource - TMEM205

Gene ID NCBI Gene 374882 |  KEGG hsa:374882
Gene Symbol TMEM205
Protein Name transmembrane protein 205
Synonyms UNQ501
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056068 IRAK140C20 pCMV-SPORT6 BC064948 NM_198536

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE096028 M01C040B04 pDONR221 MGC09-H02 BC064948 NM_198536  
HGE096076 M01C040D04 pDONR221 MGC09-H02 BC064948 NM_198536  
HGE096124 M01C040F04 pDONR221 MGC09-H02 BC064948 NM_198536  
HGE096172 M01C040H04 pDONR221 MGC09-H02 BC064948 NM_198536  
HGE096220 M01C040J04 pDONR221 MGC09-H02 BC064948 NM_198536  
HGE096268 M01C040L04 pDONR221 MGC09-H02 BC064948 NM_198536  
HGE096316 M01C040N04 pDONR221 MGC09-H02 BC064948 NM_198536  
HGE096364 M01C040P04 pDONR221 MGC09-H02 BC064948 NM_198536  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR320575 RBb01H07 pKA1U5 NM_198536.1  
AGCTGGGAGGCGGGACGAATTATTGGTTGGGGGAAACCCACGAGGGGACGCGGCCGAGGA
HKR368425 RBd21B01 pGCAP10 NM_198536.1  
GGAAACCCACGAGGGGACGCGGCCGAGGAGGGTCGCTGTCCACCCGGGGGCGTGGGAGTG
HKR392873 RBd82D01 pGCAP10 NM_198536.1  
GATTGGTTGGGGGAAACCCACGAGGGGACGCGGCCGAGGAGGGTCGCTGTCCACCCGGGG
HKR399732 RBd99F12 pGCAP10 NM_198536.1  
GAGCTGGGAGGCGGGACGAATTATTGGTTGGGGGAAACCCACGAGGGGACGCGGCCGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl