Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10437

HP ID(1) HP10437
Gene ID(2) 90843
Gene Symbol finder TCEAL8
Protein Name transcription elongation factor A (SII)-like 8
RefSeq NM_153333.2
Length of RefSeq (bp) 1231
Chromosome Xq22.1
Reference DDBJ accession
UniGene Hs.389734

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe30F09 pKA1U5 GCCTTATAGTCCAGGGCCTGTTTCCCTGTAGCAGCTCCTTATTGCTGGAGAAGGAGAAAA
RBb39C08 pGCAP1 GGAAGTCCTTATAGGTCCAGGGCCTGTTTTCCCTGNTAGCAGCTCCTTATTGCTGGAGAA
RBb63F10 pGCAP1 TTTTATTATACTCTTAGGGATTCCTTAAGATTTGCCTTATAGTCCAGGGCCTGTTTCCCT
RBd69A10 pGCAP10 GAGGAGTCGACGTGTGCAGAAGTCCTTATAGTCCAGGGCCTGTTTCCCTGTAGCAGCTCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl