Prev. | 

RIKEN DNA Bank Human Resource - TCEAL8

Gene ID NCBI Gene 90843 |  KEGG hsa:90843
Gene Symbol TCEAL8
Protein Name transcription elongation factor A like 8
Synonyms WEX3
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027675 IRAK069D03 pCMV-SPORT6 BC035573 NM_153333 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052129 ARe30F09 pKA1U5 NM_153333.2  
GCCTTATAGTCCAGGGCCTGTTTCCCTGTAGCAGCTCCTTATTGCTGGAGAAGGAGAAAA
HKR335656 RBb39C08 pGCAP1 NM_153333.2  
GGAAGTCCTTATAGGTCCAGGGCCTGTTTTCCCTGNTAGCAGCTCCTTATTGCTGGAGAA
HKR345330 RBb63F10 pGCAP1 NM_153333.2  
TTTTATTATACTCTTAGGGATTCCTTAAGATTTGCCTTATAGTCCAGGGCCTGTTTCCCT
HKR387610 RBd69A10 pGCAP10 NM_153333.2  
GAGGAGTCGACGTGTGCAGAAGTCCTTATAGTCCAGGGCCTGTTTCCCTGTAGCAGCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl