Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10435

HP ID(1) HP10435
Gene ID(2) 51374
Gene Symbol finder C2orf28
Protein Name chromosome 2 open reading frame 28
RefSeq NM_080592.2
Length of RefSeq (bp) 1277
Chromosome 2p23.3
Reference DDBJ accession
UniGene Hs.9527

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS122J17 pGCAP10 GAACGGAAAATGGCGCCTCACGGCCCGGGTAGTCTTACGACCCTGGTGCCCTGGGCTGCC
RBb23E01 pGCAP1 AAATGTGGGGAGCACCAAGGGAACGGAAAATGGCGCCTCACGGCCCGGGTAGTCTTACGA
RBb38G04 pGCAP1 GGTCCGGACGCGGGGAACACCGGGCTGAGGGAGTCTGCAGTCGGCTCCGGGAAGCCGCGC
RBb57A07 pGCAP1 GGGGGCCGGGCTCGCGCGAGCAGCGGAGCACCAAGGGAACGGAAAATGGCGCCTCACGGC
RBb67C02 pGCAP1 GAACGGAAAATGGCGCCTCACGGCCCGGGTAGTCTTACGACCCTGGTGCCCTGGGCTGCC
RBdS007J06 pGCAP10 GGGAGCACCAAGGGAACGGAAAATGGCGCCTCACGGCCCGGGTAGTCTTACGACCCTGGT
RBdS014J23 pGCAP10 GGTTTCTGCGAAGCCGCGACCTCGGCGTCCGGACGCGGGGAACACCGGGCTGAGGGAGTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl