Prev. | 

RIKEN DNA Bank Human Resource - ATRAID

Gene ID NCBI Gene 51374 |  KEGG hsa:51374
Gene Symbol ATRAID
Protein Name all-trans retinoic acid induced differentiation factor
Synonyms APR--3|APR-3|APR3|C2orf28|HSPC013|PRO240|p18
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX031924 IRAK079N12 pCMV-SPORT6 BC035850 NM_016085 Full
HGY085120 IRAL012N08 pOTB7 BC002846 NM_016085 Full
HGY087743 IRAL019F23 pDNR-LIB BC011006 NM_016085 Full
HGY090781 IRAL026P21 pOTB7 BC021237 NM_016085 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE098043 M01C045B19 pDONR221 MGC12-C10 BC002846 NM_016085  
HGE098091 M01C045D19 pDONR221 MGC12-C10 BC002846 NM_016085  
HGE098139 M01C045F19 pDONR221 MGC12-C10 BC002846 NM_016085  
HGE098187 M01C045H19 pDONR221 MGC12-C10 BC002846 NM_016085  
HGE098235 M01C045J19 pDONR221 MGC12-C10 BC002846 NM_016085  
HGE098283 M01C045L19 pDONR221 MGC12-C10 BC002846 NM_016085  
HGE098331 M01C045N19 pDONR221 MGC12-C10 BC002846 NM_016085  
HGE098379 M01C045P19 pDONR221 MGC12-C10 BC002846 NM_016085  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR249033 ARiS122J17 pGCAP10 NM_080592.2  
GAACGGAAAATGGCGCCTCACGGCCCGGGTAGTCTTACGACCCTGGTGCCCTGGGCTGCC
HKR329297 RBb23E01 pGCAP1 NM_080592.2  
AAATGTGGGGAGCACCAAGGGAACGGAAAATGGCGCCTCACGGCCCGGGTAGTCTTACGA
HKR335348 RBb38G04 pGCAP1 NM_080592.2  
GGTCCGGACGCGGGGAACACCGGGCTGAGGGAGTCTGCAGTCGGCTCCGGGAAGCCGCGC
HKR342807 RBb57A07 pGCAP1 NM_080592.2  
GGGGGCCGGGCTCGCGCGAGCAGCGGAGCACCAAGGGAACGGAAAATGGCGCCTCACGGC
HKR346850 RBb67C02 pGCAP1 NM_080592.2  
GAACGGAAAATGGCGCCTCACGGCCCGGGTAGTCTTACGACCCTGGTGCCCTGGGCTGCC
HKR403022 RBdS007J06 pGCAP10 NM_080592.2  
GGGAGCACCAAGGGAACGGAAAATGGCGCCTCACGGCCCGGGTAGTCTTACGACCCTGGT
HKR405839 RBdS014J23 pGCAP10 NM_080592.2  
GGTTTCTGCGAAGCCGCGACCTCGGCGTCCGGACGCGGGGAACACCGGGCTGAGGGAGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl