Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10432

HP ID(1) HP10432
Gene ID(2) 51330
Gene Symbol finder TNFRSF12A
Protein Name tumor necrosis factor receptor superfamily, member 12A
RefSeq NM_016639.2
Length of RefSeq (bp) 1048
Chromosome 16p13.3
Reference DDBJ accession
UniGene Hs.355899

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe05G06 pKA1U5 GGGGCGCAGACAGCGGCGGGCGCAGGACGTGCACTATGGCTCGGGGCTCGCTGCGCCGGT
ARe38E12 pKA1U5 GGCAGACAGCGGCGGGCGCAGGACGTGCACTATGGCTCGGGGCTCGCTGCGCCGGTTGCT
ARe60C11 pKA1U5 GCCCTGCCGGCCGGCGGCGGGCGCAGACAGCGGCGGGCGCAGGACGTGCACTATGGCTCG
ARe81D09 pKA1U5 GGCCGGCCGGCGGCGGGCGCAGACAGCGGCGGGCGCAGGACGTGCACTATGGCTCGGGGC
ARi30D12 pGCAP10 GGGCCGTGGGTCCCTGCCGGCCGGCGGCGGGCGCAGACAGCGGCGGGCGCAGGACGTGCA
ARi42E04 pGCAP10 GGACAAGTGCATGGACTGCGCGTCTTGCAGGGCGCGACCGCACAGCGACTTCTGCCTGGG
ARi43H11 pGCAP10 GGACAGCGGCGGGCGCAGGACGTGCACTATGGCTCGGGGCTCGCTGCGCCGGTTGCTGCG
ARiS013E15 pGCAP10 GGACAGCGGCGGGCNCANGACGTGCACTATGGCTCGGGGCTCGCTGCGCCGGTTGCTGCG
ARiS049L21 pGCAP10 ACGGCAGACAGCGGCGGGCGCAGGACGTGCACTATGGCTCGGGGCTCGCTGCGCCGGTTG
ARiS109K18 pGCAP10 GAGACAGCGGCGGGCGCAGGACGTGCACTATGGCTCGGGGCTCGCTGCGCCGGTTGCTGC
ARiS150H02 pGCAP10 GAGCGGCGGGCGCAGGACGTGCACTATGGCTCGGGGCTCGCTGCGCCGGTTGCTGCGGCT
ARiS194P16 pGCAP10 GCTGCCGGCCGGCGGCGGNCGCAGACAGCGGCGGGCGCAGGACGTGCACTATGGCTCGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl