Prev. |  KEGG KO K05149 > 

RIKEN DNA Bank Human Resource - TNFRSF12A

Gene ID NCBI Gene 51330 |  KEGG hsa:51330
Gene Symbol TNFRSF12A
Protein Name TNF receptor superfamily member 12A
Synonyms CD266|FN14|TWEAKR
Ortholog resource in our bank

  TNFRSF12A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX055755 IRAK139G11 pCMV-SPORT6 BC064377 NM_016639 Full/var
HGY084870 IRAL012C22 pOTB7 BC002718 NM_016639 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE023305 W01A058E09 pENTR-TOPO IRAL012C22 BC002718 NM_016639  
HGE023307 W01A058E11 pENTR-TOPO IRAL012C22 BC002718 NM_016639  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042150 ARe05G06 pKA1U5 NM_016639.2  
GGGGCGCAGACAGCGGCGGGCGCAGGACGTGCACTATGGCTCGGGGCTCGCTGCGCCGGT
HKR055308 ARe38E12 pKA1U5 NM_016639.2  
GGCAGACAGCGGCGGGCGCAGGACGTGCACTATGGCTCGGGGCTCGCTGCGCCGGTTGCT
HKR064059 ARe60C11 pKA1U5 NM_016639.2  
GCCCTGCCGGCCGGCGGCGGGCGCAGACAGCGGCGGGCGCAGGACGTGCACTATGGCTCG
HKR072481 ARe81D09 pKA1U5 NM_016639.2  
GGCCGGCCGGCGGCGGGCGCAGACAGCGGCGGGCGCAGGACGTGCACTATGGCTCGGGGC
HKR172084 ARi30D12 pGCAP10 NM_016639.2  
GGGCCGTGGGTCCCTGCCGGCCGGCGGCGGGCGCAGACAGCGGCGGGCGCAGGACGTGCA
HKR176900 ARi42E04 pGCAP10 NM_016639.2  
GGACAAGTGCATGGACTGCGCGTCTTGCAGGGCGCGACCGCACAGCGACTTCTGCCTGGG
HKR177379 ARi43H11 pGCAP10 NM_016639.2  
GGACAGCGGCGGGCGCAGGACGTGCACTATGGCTCGGGGCTCGCTGCGCCGGTTGCTGCG
HKR205311 ARiS013E15 pGCAP10 NM_016639.2  
GGACAGCGGCGGGCNCANGACGTGCACTATGGCTCGGGGCTCGCTGCGCCGGTTGCTGCG
HKR219885 ARiS049L21 pGCAP10 NM_016639.2  
ACGGCAGACAGCGGCGGGCGCAGGACGTGCACTATGGCTCGGGGCTCGCTGCGCCGGTTG
HKR243858 ARiS109K18 pGCAP10 NM_016639.2  
GAGACAGCGGCGGGCGCAGGACGTGCACTATGGCTCGGGGCTCGCTGCGCCGGTTGCTGC
HKR260170 ARiS150H02 pGCAP10 NM_016639.2  
GAGCGGCGGGCGCAGGACGTGCACTATGGCTCGGGGCTCGCTGCGCCGGTTGCTGCGGCT
HKR277976 ARiS194P16 pGCAP10 NM_016639.2  
GCTGCCGGCCGGCGGCGGNCGCAGACAGCGGCGGGCGCAGGACGTGCACTATGGCTCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl