Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10423

HP ID(1) HP10423
Gene ID(2) 56984
Gene Symbol finder PSMG2
Protein Name proteasome (prosome, macropain) assembly chaperone 2
RefSeq NM_020232.3
Length of RefSeq (bp) 1064
Chromosome 18p11.21
Reference DDBJ accession
UniGene Hs.464652

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS088M15 pGCAP10 GGGGGTCTCGGGCTTCCGCCTTCTTGCTGCCCTCGTTCTTGCCGGGGCCGCGGTTAGTCC
ARiS191J02 pGCAP10 GGCCTTCTTGCTGCCCTCGTTCTTGCCAGGGCCGCGGTTAGTCCCTGCTGGCCACCCCAC
RBb53H08 pGCAP1 GCGCCTTCTTGCTGCCCTCGTTCTTGCCGGGGCCGCGGTTTAGTCCCTGCTGGCCACCCC
RBd18A08 pGCAP10 GGGGGTCTCGGGCTTCCGCCTTCTTGCTGCCCTCGTTCTTGCCAGGGCCGCGGTTAGTCC
RBd45E08 pGCAP10 GGGGCTTCCGCCTTCTTGCTGCCCTCGTTCTTGCCAGGGCCGCGGTTAGTCCCTGCTGGC
RBd85E07 pGCAP10 TGCCGGGGTCTCGGGCTTCCGCCTTCTTGCTGCCCTCGTTCTTGCCAGGGCCGCGGTTAG
RBdS110E09 pGCAP10 GGCGGTTAGTCCCTGCTGGCCACCCCACTGCGACCATGTTCGTTCCCTGCGGGGAGTCGG
RBdS187C10 pGCAP10 GGACTCAAAGGACCCTCCCGCGCCCCGCGAGGCTCCGGGGTCTCGGGCTTCCGCCTTCTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl