Prev. |  KEGG KO K11876 > 

RIKEN DNA Bank Human Resource - PSMG2

Gene ID NCBI Gene 56984 |  KEGG hsa:56984
Gene Symbol PSMG2
Protein Name proteasome assembly chaperone 2
Synonyms CLAST3|HCCA3|HsT1707|MDS003|PAC2|TNFSF5IP1
Ortholog resources KEGG ortholog (KEGG orthology K11876) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY089938 IRAL024O02 pOTB7 BC013356 NM_020232

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR235503 ARiS088M15 pGCAP10 NM_020232.3  
GGGGGTCTCGGGCTTCCGCCTTCTTGCTGCCCTCGTTCTTGCCGGGGCCGCGGTTAGTCC
HKR276618 ARiS191J02 pGCAP10 NM_020232.3  
GGCCTTCTTGCTGCCCTCGTTCTTGCCAGGGCCGCGGTTAGTCCCTGCTGGCCACCCCAC
HKR341376 RBb53H08 pGCAP1 NM_020232.3  
GCGCCTTCTTGCTGCCCTCGTTCTTGCCGGGGCCGCGGTTTAGTCCCTGCTGGCCACCCC
HKR367208 RBd18A08 pGCAP10 NM_020232.3  
GGGGGTCTCGGGCTTCCGCCTTCTTGCTGCCCTCGTTCTTGCCAGGGCCGCGGTTAGTCC
HKR378104 RBd45E08 pGCAP10 NM_020232.3  
GGGGCTTCCGCCTTCTTGCTGCCCTCGTTCTTGCCAGGGCCGCGGTTAGTCCCTGCTGGC
HKR394103 RBd85E07 pGCAP10 NM_020232.3  
TGCCGGGGTCTCGGGCTTCCGCCTTCTTGCTGCCCTCGTTCTTGCCAGGGCCGCGGTTAG
HKR444105 RBdS110E09 pGCAP10 NM_020232.3  
GGCGGTTAGTCCCTGCTGGCCACCCCACTGCGACCATGTTCGTTCCCTGCGGGGAGTCGG
HKR474858 RBdS187C10 pGCAP10 NM_020232.3  
GGACTCAAAGGACCCTCCCGCGCCCCGCGAGGCTCCGGGGTCTCGGGCTTCCGCCTTCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl