Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10411

HP ID(1) HP10411
Gene ID(2) 129787
Gene Symbol finder TMEM18
Protein Name transmembrane protein 18
RefSeq NM_152834.2
Length of RefSeq (bp) 2138
Chromosome 2p25.3
Reference DDBJ accession
UniGene Hs.43899

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe22D03 pKA1U5 GCTCTGTGGATTCTGGCCAGGCCGGGTTCGGCGGTTGCTGTGAGAGCGGGCTTCCCAACA
ARe30A09 pKA1U5 GGGATTCTGGCCAGGCCGGGTTCGGCGGTTGCTGTGAGAGCGGGCTTCCCAACACCATGC
RBd01F09 pGCAP10 GGATTTGGCGCCCTCCTCTGTGGATTCTGGCCAGGCCGGGTTCGGCGGTTGCTGTGAGAG
RBd03D05 pGCAP10 GGTGGATTCTGGCCAGGCCGGGTTCGGCGGTTGCTGTGAGAGCGGGCTTCCCAACACCAT
RBdS156O20 pGCAP10 ATTTTGGCGCCCTCCTCTGTGGATTCTGGCCAGGCCGGGTTCGGCGGTTGCTGTGAGAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl