Prev. | 

RIKEN DNA Bank Human Resource - TMEM18

Gene ID NCBI Gene 129787 |  KEGG hsa:129787
Gene Symbol TMEM18
Protein Name transmembrane protein 18
Synonyms lncND
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025693 IRAK064D21 pCMV-SPORT6 BC032379 NM_152834 Full/var
HGY095439 IRAL038J23 pDNR-LIB BC016010 NM_152834 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR048875 ARe22D03 pKA1U5 NM_152834.2  
GCTCTGTGGATTCTGGCCAGGCCGGGTTCGGCGGTTGCTGTGAGAGCGGGCTTCCCAACA
HKR052009 ARe30A09 pKA1U5 NM_152834.2  
GGGATTCTGGCCAGGCCGGGTTCGGCGGTTGCTGTGAGAGCGGGCTTCCCAACACCATGC
HKR360529 RBd01F09 pGCAP10 NM_152834.2  
GGATTTGGCGCCCTCCTCTGTGGATTCTGGCCAGGCCGGGTTCGGCGGTTGCTGTGAGAG
HKR361277 RBd03D05 pGCAP10 NM_152834.2  
GGTGGATTCTGGCCAGGCCGGGTTCGGCGGTTGCTGTGAGAGCGGGCTTCCCAACACCAT
HKR462756 RBdS156O20 pGCAP10 NM_152834.2  
ATTTTGGCGCCCTCCTCTGTGGATTCTGGCCAGGCCGGGTTCGGCGGTTGCTGTGAGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl