Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10354

HP ID(1) HP10354
Gene ID(2) 29095
Gene Symbol finder ORMDL2
Protein Name ORM1-like 2 (S. cerevisiae)
RefSeq NM_014182.4
Length of RefSeq (bp) 1361
Chromosome 12q13.2
Reference DDBJ accession
UniGene Hs.534450

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe70A12 pKA1U5 TGATAGCCGGACGGGGATCTGAGCTGGCAGGATGAATGTGGGGGTGGCACACAGCGAAGT
RBdS154L19 pGCAP10 GGCGTTACTTCCTGGAGACTTCAGGTGTGGTAGCCGGCGCCGCGCCCATAGCCGGACGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl