Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154L19

Clone ID RBdS154L19
HP ID HP10354
Gene ID 29095
Gene Symbol ORMDL2
Protein Name ORM1-like 2 (S. cerevisiae)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_014182.4
Length of RefSeq (bp) 1361
Chromosome 12q13.2
Reference DDBJ accession
UniGene Hs.534450
5'-terminal sequence GGCGTTACTTCCTGGAGACTTCAGGTGTGGTAGCCGGCGCCGCGCCCATAGCCGGACGGG
2011.08.28