Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10342

HP ID(1) HP10342
Gene ID(2) 11243
Gene Symbol finder PMF1
Protein Name polyamine-modulated factor 1
RefSeq NM_007221.2
Length of RefSeq (bp) 1082
Chromosome 1q12
Reference DDBJ accession
UniGene Hs.530479

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe85C04 pKA1U5 ATCCTGGGGAGGTTCAACTTCAACATGGCCGAAGCAAGTAGCGCCAATCTAGGCAGCGGC
ARi62H07 pGCAP10 GGGAGGTTCAACTTCAACATGGCCGAAGCAAGTAGCGCCAATCTAGGCAGCGGCTGTGAG
RBb48D05 pGCAP1 GGGAGGTTCAACTTCAACATGGCCGAAGCAAGTAGCGCCAATCTAGGCAGCGGCTGTGAG
RBd11C10 pGCAP10 GGGAGGTTCAACTTCAACATGGCCGAAGCAAGTAGCGCCAATCTAGGCAGCGGCTGTGAG
RBd51H04 pGCAP10 GAACTTCAACATGGCCGAAGCAAGTAGCGCCAATCTAGGCAGCGGCTGTGAGGAAAAAAG
RBdS083D07 pGCAP10 GAACTTCAACATGGCCGAAGCAAGTAGCGCCAATCTAGGCAGCGGCTGTGAGGAAAAAAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl