Prev. |  KEGG KO K11546 > 

RIKEN DNA Bank Human Resource - PMF1

Gene ID NCBI Gene 11243 |  KEGG hsa:11243
Gene Symbol PMF1
Protein Name polyamine modulated factor 1
Synonyms -
Ortholog resource in our bank

  PMF1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044209 IRAK110I17 pCMV-SPORT6 BC050735 NM_007221 Partial
HGX047809 IRAK119I17 pCMV-SPORT6 BC056417 NM_007221 Partial
HGX056219 IRAK140J03 pCMV-SPORT6 BC065031 NM_007221 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR074052 ARe85C04 pKA1U5 NM_007221.2  
ATCCTGGGGAGGTTCAACTTCAACATGGCCGAAGCAAGTAGCGCCAATCTAGGCAGCGGC
HKR184975 ARi62H07 pGCAP10 NM_007221.2  
GGGAGGTTCAACTTCAACATGGCCGAAGCAAGTAGCGCCAATCTAGGCAGCGGCTGTGAG
HKR339277 RBb48D05 pGCAP1 NM_007221.2  
GGGAGGTTCAACTTCAACATGGCCGAAGCAAGTAGCGCCAATCTAGGCAGCGGCTGTGAG
HKR364458 RBd11C10 pGCAP10 NM_007221.2  
GGGAGGTTCAACTTCAACATGGCCGAAGCAAGTAGCGCCAATCTAGGCAGCGGCTGTGAG
HKR380572 RBd51H04 pGCAP10 NM_007221.2  
GAACTTCAACATGGCCGAAGCAAGTAGCGCCAATCTAGGCAGCGGCTGTGAGGAAAAAAG
HKR433279 RBdS083D07 pGCAP10 NM_007221.2  
GAACTTCAACATGGCCGAAGCAAGTAGCGCCAATCTAGGCAGCGGCTGTGAGGAAAAAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl