Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10327

HP ID(1) HP10327
Gene ID(2) 112597
Gene Symbol finder NCRNA00152
Protein Name non-protein coding RNA 152
RefSeq NR_024204.1
Length of RefSeq (bp) 828
Chromosome 2p11.2
Reference DDBJ accession
UniGene Hs.652166

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe55E12 pKA1U5 GATTGGGAATGGAGGGAAATAAATGACTGGANCCTNTTNNGCTTTTTAAGTTTCANATTG
ARe76A05 pKA1U5 GCTTAGTCGTGTGTACATCATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT
ARe78E01 pKA1U5 GCTTAGTCGTGTGTACATCATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT
ARi31E01 pGCAP10 GCTTAGTCGTGTGTACATCATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT
ARi58B03 pGCAP10 TGAGTTTCAAATTGACATTCCAGACAAGCGGTGCCTGAGCCTGTGCCTGTCTTCAGATCT
ARiS049D11 pGCAP10 GCTTAGTCGTGTGTACATCATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT
ARiS191J22 pGCAP10 GATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCTTTTTAAGTTTCAAATTGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl