Prev. | 

RIKEN DNA Bank Human Resource - CYTOR

Gene ID NCBI Gene 112597 |  KEGG hsa:112597
Gene Symbol CYTOR
Protein Name cytoskeleton regulator RNA
Synonyms C2orf59|LINC00152|NCRNA00152
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007889 IRAK019M01 pCMV-SPORT6 BC010491 NM_052871 Full
HGY084633 IRAL011J17 pOTB7 BC009508 NM_052871 Full
HGY103166 IRAL057P06 pDNR-LIB BC070202 NM_052871 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098020 M01C045A20 pDONR221 MGC12-B10 BC009508 NM_052871  
HGE098068 M01C045C20 pDONR221 MGC12-B10 BC009508 NM_052871  
HGE098116 M01C045E20 pDONR221 MGC12-B10 BC009508 NM_052871  
HGE098164 M01C045G20 pDONR221 MGC12-B10 BC009508 NM_052871  
HGE098212 M01C045I20 pDONR221 MGC12-B10 BC009508 NM_052871  
HGE098260 M01C045K20 pDONR221 MGC12-B10 BC009508 NM_052871  
HGE098308 M01C045M20 pDONR221 MGC12-B10 BC009508 NM_052871  
HGE098356 M01C045O20 pDONR221 MGC12-B10 BC009508 NM_052871  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR062108 ARe55E12 pKA1U5 NR_024204.1  
GATTGGGAATGGAGGGAAATAAATGACTGGANCCTNTTNNGCTTTTTAAGTTTCANATTG
HKR070405 ARe76A05 pKA1U5 NR_024204.1  
GCTTAGTCGTGTGTACATCATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT
HKR071297 ARe78E01 pKA1U5 NR_024204.1  
GCTTAGTCGTGTGTACATCATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT
HKR172497 ARi31E01 pGCAP10 NR_024204.1  
GCTTAGTCGTGTGTACATCATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT
HKR183227 ARi58B03 pGCAP10 NR_024204.1  
TGAGTTTCAAATTGACATTCCAGACAAGCGGTGCCTGAGCCTGTGCCTGTCTTCAGATCT
HKR219683 ARiS049D11 pGCAP10 NR_024204.1  
GCTTAGTCGTGTGTACATCATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT
HKR276638 ARiS191J22 pGCAP10 NR_024204.1  
GATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCTTTTTAAGTTTCAAATTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl