Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10311

HP ID(1) HP10311
Gene ID(2) 10397
Gene Symbol finder NDRG1
Protein Name N-myc downstream regulated 1
RefSeq NM_006096.3
Length of RefSeq (bp) 3123
Chromosome 8q24.3
Reference DDBJ accession
UniGene Hs.372914

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS087F11 pGCAP10 AAAACCTCGCCTGGCTCCCAGCTGGTGCTGAAGCTCGTCAGTTCACCATCCGCCCTCGGC
RBdS104J12 pGCAP10 GACCNCNNCTGGCTCCCAGCTGGTGCTGAAGCTCGTCAGTTCACCATCCGCCCTCGGCTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl