DNA Bank Top |  KEGG KO K18266 > 

RIKEN DNA Bank Human Resource - NDRG1

Gene ID NCBI Gene 10397 |  KEGG hsa:10397
Gene Symbol NDRG1
Protein Name N-myc downstream regulated 1
Synonyms CAP43|CMT4D|DRG-1|DRG1|GC4|HMSNL|NDR1|NMSL|PROXY1|RIT42|RTP|TARG1|TDD5

Link

Ortholog resource in our bank

  NDRG1

External database

human NDRG1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB19918 NDRG1 Gateway entry vector of N-myc downstream regulated 1 (NDRG1)    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083784 IRAL009H16 pOTB7 BC003175 NM_006096 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR234931 ARiS087F11 pGCAP10 NM_006096.3  
AAAACCTCGCCTGGCTCCCAGCTGGTGCTGAAGCTCGTCAGTTCACCATCCGCCCTCGGC
HKR441828 RBdS104J12 pGCAP10 NM_006096.3  
GACCNCNNCTGGCTCCCAGCTGGTGCTGAAGCTCGTCAGTTCACCATCCGCCCTCGGCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.01

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl