Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NDRG1

Gene ID (NCBI) 10397
Gene Symbol NDRG1
Protein Name N-myc downstream regulated 1
Synonyms CAP43|CMT4D|DRG-1|DRG1|GC4|HMSNL|NDR1|NMSL|PROXY1|RIT42|RTP|TARG1|TDD5
Databases KEGG hsa:10397 |  NCBI Gene 10397
Featured content Ortholog resources in the DNA Bank (KEGG orthology K18266)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY083784 IRAL009H16 pOTB7 BC003175 NM_006096 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR234931 ARiS087F11 pGCAP10 NM_006096.3  
AAAACCTCGCCTGGCTCCCAGCTGGTGCTGAAGCTCGTCAGTTCACCATCCGCCCTCGGC
HKR441828 RBdS104J12 pGCAP10 NM_006096.3  
GACCNCNNCTGGCTCCCAGCTGGTGCTGAAGCTCGTCAGTTCACCATCCGCCCTCGGCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.02.26

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl