Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10306

HP ID(1) HP10306
Gene ID(2) 55851
Gene Symbol finder PSENEN
Protein Name presenilin enhancer 2 homolog (C. elegans)
RefSeq NM_172341.1
Length of RefSeq (bp) 678
Chromosome 19q13.12
Reference DDBJ accession
UniGene Hs.534465

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi18E09 pGCAP10 GAACTGAAAGTAGCTAAGGCACCCCAGCCGGAGGAAGTGAGCTCTCCTGGGGCGTGGTTG
ARiS198M21 pGCAP10 GGGGGCGTCTCGCGCAAACGTCCATAACTGAAAGTAGCTAAGGCACCCCAGCCGGAGGAA
RBd21F10 pGCAP10 GGCCCAAAGAAGACTACAATCTCCAGGGAAACCTGGGGCGTCTCGCGCAAACGTCCATAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl