Prev. |  KEGG KO K06170 > 

RIKEN DNA Bank Human Resource - PSENEN

Gene ID NCBI Gene 55851 |  KEGG hsa:55851
Gene Symbol PSENEN
Protein Name presenilin enhancer, gamma-secretase subunit
Synonyms ACNINV2|MDS033|MSTP064|PEN-2|PEN2
Featured content Notch signaling pathway (human)
Featured content Alzheimer disease - human
Ortholog resource in our bank

  PSENEN

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088667 IRAL021L03 pDNR-LIB BC009575 NM_172341 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR167305 ARi18E09 pGCAP10 NM_172341.1  
GAACTGAAAGTAGCTAAGGCACCCCAGCCGGAGGAAGTGAGCTCTCCTGGGGCGTGGTTG
HKR279509 ARiS198M21 pGCAP10 NM_172341.1  
GGGGGCGTCTCGCGCAAACGTCCATAACTGAAAGTAGCTAAGGCACCCCAGCCGGAGGAA
HKR368530 RBd21F10 pGCAP10 NM_172341.1  
GGCCCAAAGAAGACTACAATCTCCAGGGAAACCTGGGGCGTCTCGCGCAAACGTCCATAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl