Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10297

HP ID(1) HP10297
Gene ID(2) 252839
Gene Symbol finder TMEM9
Protein Name transmembrane protein 9
RefSeq NM_016456.2
Length of RefSeq (bp) 1592
Chromosome 1q41
Reference DDBJ accession
UniGene Hs.181444

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb20C01 pKA1U5 ATCCTGGTCTTTTGCGGCTGCAGCGGGCTTGTAGGTGTCCGGCTTTGCTGGCCCAGCAAG
RBb29E01 pGCAP1 GGGGCTTGTAGGTGTCCGGCTTTGCTGGCCCAGCAAGCCTGATAAGCATGAAGCTCTTAT
RBdS013B14 pGCAP10 GGGGGACAACTGGGTCTTTTGCGGCTGCAGCGGGCTTGTAGGTGTCCGGCTTTGCTGGCC
RBdS013K13 pGCAP10 GAGGAGAGGGCGGGGACAACTGGGTCTTTTGCGGCTGCAGCGGGCTTGTAGGTGTCCGGC
RBdS014E08 pGCAP10 GACCCGAGAGCAGGAGCTGAAAGCCTCTAACACCCACAGATCCCTCTATGACTGCAATGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl