Prev. | 

RIKEN DNA Bank Human Resource - TMEM9

Gene ID NCBI Gene 252839 |  KEGG hsa:252839
Gene Symbol TMEM9
Protein Name transmembrane protein 9
Synonyms DERM4|TMEM9A
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082847 IRAL007B23 pOTB7 BC001106 NM_016456 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE021036 W01A052J20 pENTR-TOPO flj0008o13 AK091726 NM_016456  
HGE021038 W01A052J22 pENTR-TOPO flj0008o13 AK091726 NM_016456  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR328049 RBb20C01 pKA1U5 NM_016456.2  
ATCCTGGTCTTTTGCGGCTGCAGCGGGCTTGTAGGTGTCCGGCTTTGCTGGCCCAGCAAG
HKR331697 RBb29E01 pGCAP1 NM_016456.2  
GGGGCTTGTAGGTGTCCGGCTTTGCTGGCCCAGCAAGCCTGATAAGCATGAAGCTCTTAT
HKR405238 RBdS013B14 pGCAP10 NM_016456.2  
GGGGGACAACTGGGTCTTTTGCGGCTGCAGCGGGCTTGTAGGTGTCCGGCTTTGCTGGCC
HKR405453 RBdS013K13 pGCAP10 NM_016456.2  
GAGGAGAGGGCGGGGACAACTGGGTCTTTTGCGGCTGCAGCGGGCTTGTAGGTGTCCGGC
HKR405704 RBdS014E08 pGCAP10 NM_016456.2  
GACCCGAGAGCAGGAGCTGAAAGCCTCTAACACCCACAGATCCCTCTATGACTGCAATGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl